*** MicroRazerS - Rapid Alignment of Small RNA Reads ***
http://www.seqan.de/projects/microRazers.html

---------------------------------------------------------------------------
Table of Contents
---------------------------------------------------------------------------
  1.   Overview
  2.   Installation
  3.   Usage
  4.   Output Format
  5.   Contact

---------------------------------------------------------------------------
1. Overview
---------------------------------------------------------------------------

MicroRazerS is a tool for mapping millions of short reads obtained from small 
RNA sequencing onto a reference genome. MicroRazerS searches for the longest 
perfect prefix match of each read where the minimum prefix match length (the 
seed length) can currently be varied between 14 and 22. Optionally, one 
mismatch can be tolerated in the seed. MicroRazerS guarantees to find all 
matches and reports a configurable maximum number of equally-best matches. 
Perfect matches are given preference over matches containing mismatches, even 
if this means mapping a shorter prefix.
Similar to RazerS, MicroRazerS uses a k-mer index of all reads and counts 
common k-mers of reads and the reference genome in parallelograms. In 
MicroRazerS, this index is built over the first seedlength many bases of each 
read only. Each parallelogram with a k-mer count above a certain threshold 
triggers a verification. On success, the genomic subsequence and the read 
number are stored and later written to the output file.

---------------------------------------------------------------------------
2. Installation
---------------------------------------------------------------------------

MicroRazerS is distributed with SeqAn - The C++ Sequence Analysis Library 
(see http://www.seqan.de). To build MicroRazerS do the following:

  1)  Download the latest snapshot of SeqAn
  2)  Unzip it to a directory of your choice (e.g. snapshot)
  3)  cd snapshot/apps
  4)  make micro_razers
  5)  cd micro_razers
  6)  ./micro_razers --help

Alternatively you can check out the latest SVN version of MicroRazerS and SeqAn
with:

  1)  svn co http://svn.mi.fu-berlin.de/seqan/trunk/seqan
  2)  cd seqan
  3)  make forwards
  4)  cd projects/library/apps
  5)  make micro_razers
  6)  cd micro_razers
  7)  ./micro_razers --help

On success, an executable file micro_razers was built and a brief usage 
description was dumped.

---------------------------------------------------------------------------
3. Usage
---------------------------------------------------------------------------

To get a short usage description of MicroRazerS, you can execute micro_razers -h or 
micro_razers --help.

Usage: micro_razers [OPTION]... <GENOME FILE> <READS FILE>

MicroRazerS expects the names of two DNA (multi-)Fasta files. The first contains 
a reference genome and the second contains the reads that should be 
mapped against the reference. Without any additional parameters MicroRazerS 
would map all reads against both strands of the reference genome requiring a perfect 
prefix seed match of length >= 16. The up tp 100 equally best (longest) matches 
would then be dumped in the default output file, the read file name extended by the 
suffix ".result".
The default behaviour can be modified by adding the following options to 
the command line:

---------------------------------------------------------------------------
3.1. Main Options
---------------------------------------------------------------------------

  [ -sL NUM ],  [ --seed-length NUM ]
  
  Seed length parameter. Minimum length of prefix match.

  [ -sE ],  [ --seed-error ]
  
  Allow for one mismatch in the prefix seed.

  [ -f ],  [ --forward ]

  Only map reads against the positive/forward strand of the genome. By
  default, both strands are scanned.

  [ -r ],  [ --reverse ]

  Only map reads against the negative/reverse-complement strand of the
  genome. By default, both strands are scanned.

  [ -m NUM ],  [ --max-hits NUM ]
  
  Output at most NUM of the best matches.

  [ -o FILE ],  [ --output FILE ]

  Change the output filename to FILE. By default, this is the read file
  name extended by the suffix ".result".

  [ -mN ],  [ --match-N ]
  
  By default, 'N' characters in read or genome sequences equal to nothing, 
  not even to another 'N'. They are considered as errors. By activating this 
  option, 'N' equals to every other character and produces no mismatch in 
  the verification process. The filtration is not affected by this option.

  [ -pa ],  [ --purge-ambiguous ]
  
  Omit reads with more than #max-hits many equally-best matches.
  
  [ -v ],  [ --verbose ]
  
  Verbose. Print extra information and running times.

  [ -vv ],  [ --vverbose ]

  Very verbose. Like -v, but also print filtering statistics like true and
  false positives (TP/FP).

  [ -V ],  [ --version ]
  
  Print version information.

  [ -h ],  [ --help ]

  Print a brief usage summary.

---------------------------------------------------------------------------
3.2. Output Format Options
---------------------------------------------------------------------------

  [ -a ],  [ --alignment ]

  Dump the alignment for each match in the ".result" file. The alignment is
  written directly after the match and has the following format:
  #Read:   CAGGAGATAAGCTGGATCTTT
  #Genome: CAGGAGATAAGCTGGATCTTT

  [ -gn NUM ],  [ --genome-naming NUM ]

  Select how genomes are named in the output file. If NUM is 0, the Fasta
  ids of the genome sequences are used (default). If NUM is 1, the genome
  sequences are enumerated beginning with 1.

  [ -rn NUM ],  [ --read-naming NUM ]
  
  Select how reads are named in the output file. If NUM is 0, the Fasta ids 
  of the reads are used (default). If NUM is 1, the reads are enumerated
  beginning with 1. If NUM is 2, the read sequence itself is used.

  [ -so NUM ],  [ --sort-order NUM ]
  
  Select how matches are ordered in the output file. 
  If NUM is 0, matches are sorted primarily by the read number and 
  secondarily by their position in the genome sequence (default).
  If NUM is 1, matches are sorted primarily by their position in the genome
  sequence and secondarily by the read number.

  [ -pf NUM ],  [ --position-format NUM ]
  
  Select how positions are stored in the output file. 
  If NUM is 0, the gap space is used, i.e. gaps around characters are 
  enumerated beginning with 0 and the beginning and end position is the 
  postion of the gap before and after a match (default).
  If NUM is 1, the position space is used, i.e. characters are enumerated 
  beginning with 1 and the beginning and end position is the postion of the 
  first and last character involved in a match.
  
  Example: Consider the string CONCAT. The beginning and end positions 
  of the substring CAT are (3,6) in gap space and (4,6) in position space.



---------------------------------------------------------------------------
4. Output Format
---------------------------------------------------------------------------

The output file is a text file whose lines represent matches. A line 
consists of different tab-separated match values. In the following 
format:

RName 0 RLength GStrand GName GBegin GEnd PercID MatchLen

Match value description:

  RName        Name of the read sequence (see --read-naming)
  RLength      Length of the read
  GStrand      'F'=forward strand or 'R'=reverse strand
  GName        Name of the genome sequence (see --genome-naming)
  GBegin       Beginning position in the genome sequence
  GEnd         End position in the genome sequence
  PercID       Percent sequence identity within matched prefix
  MatchLen     Length of prefix match

For matches on the reverse strand, GBegin and GEnd are positions on the 
related forward strand.


---------------------------------------------------------------------------
5. Contact
---------------------------------------------------------------------------

For questions or comments, contact:
  Anne-Katrin Emde <emde@inf.fu-berlin.de>

